Background | Status & Availability | Transgene Info | Phenotypic Characterization | Breeding | Genotyping | References | Blog/Comments/Reviews | Related rats | Acknowledgements
Background
CRISPR/Cas9 technology enables the targeting of mutations to specific DNA sequences within an organism’s genome. Cas9 is a nuclease that interacts with a guide RNA (gRNA) whose sequence determines the target DNA site for the Cas9 to create a double-strand break in the genomic DNA. The endogenous repair mechanisms lead to mutant DNA sequence once a double-stranded DNA break has been made. To facilitate genome modification in the rat, we generated and characterized a strain of transgenic Long Evans rats with Cre-dependent expression of Cas9 nuclease I (LE-Rosa26Tm1(LSL-Cas9)Ottc). The RAT enables cell/tissue-specific genome modification in the rat when it is combined with a Cre recombinase via viral vector or Cre-driver rat and by providing gRNAs via viral or non-viral vectors.
Status and Availability
This strain has not yet been published.
As of March 15, 2019, this strain is available as line #00833 at the RRRC.
This rat is registered at the Rat Genome Database (RGD) ID# 13208224.
Transgene Information
Figure 1: Schematic of Rosa26-targeted Cre-dependent Cas9 transgene. The coding region for FLAG-tagged SpCas9 with nuclear-localization signals was amplified from pX458 (Addgene #48138), then inserted downstream of a CAG promoter between a flox-stop cassette and the polyadenylation signal from the gene for bovine growth hormone (pOTTC1080). The final construct was used as a donor template for homology directed repair of a CRISPR-Cas9 double-strand break targeted by the following guide RNAs:
rRosa26 A GCAGATCACGAGGGAAGAAG
rRosa26 B GAGTCTTTCTGGAAGATAGG
The donor template (OTTC1080), the gRNAs (produced by in vitro transcription), and the mRNA encoding the Cas9-nickase (Tri-Link), were injected into fertilized Long Evans rat embryos by NIMH Transgenic Core. Founder rats were identified then genotypically and phenotypically verified.
Phenotypic Characterization
Breeding Strategy
Breeding Information, click here for text version or here for PDF
Genotyping Assays
Assay for the presence of Rosa26-targeted LSL-Cas9 insert, click here
References that cite this rat
2019
Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Journal Article
In: Neuron, vol. 102, no. 1, pp. 105–119, 2019, ISSN: 1097-4199 (Electronic); 0896-6273 (Linking).
Blog/Comments/Reviews
Last Updated on November 9, 2022
There is only one surveyed report for receiving and usage of the transgenic LSL-Cas9 rats for scientific experiments.
General Health
One PI reported that the LE-Rosa26Tm1(LSL-Cas9)Ottc male breeders received from the RRRC had health issues and needed to be euthanized before a colony was established.
Weight
The are no reports of weights changes with the LE-Rosa26Tm1(LSL-Cas9)Ottc rats
Breeding
One PI reported that they could not establish breeding of LE-Rosa26Tm1(LSL-Cas9)Ottc rats due to health issues with the male breeders.
Expression
There are no reports of expression with the LE-Rosa26Tm1(LSL-Cas9)Ottc rats
Other related rats
Acknowledgements
Susanne Back, YaJun Zhang, Julie Necarsulmer, Pyry Koivula, Emily Heathward, Christopher T. Richie, Brandon Harvey, Janette Lebron