LE-Rosa26Tm1(LSL-Cas9)Ottc

Background | Status & Availability | Transgene Info | Phenotypic Characterization | Breeding | Genotyping | References | Blog/Comments/Reviews | Related rats | Acknowledgements

Background

CRISPR/Cas9 technology enables the targeting of mutations to specific DNA sequences within an organism’s genome.  Cas9 is a nuclease that interacts with a guide RNA (gRNA) whose sequence determines the target DNA site for the Cas9 to create a double-strand break in the genomic DNA.  The endogenous repair mechanisms lead to mutant DNA sequence once a double-stranded DNA break has been made.  To facilitate genome modification in the rat, we generated and characterized a strain of transgenic Long Evans rats with Cre-dependent expression of Cas9 nuclease I (LE-Rosa26Tm1(LSL-Cas9)Ottc).   The RAT enables cell/tissue-specific genome modification in the rat when it is combined with a Cre recombinase via viral vector or Cre-driver rat and by providing gRNAs via viral or non-viral vectors.

Status and Availability

This strain has not yet been published.
As of March 15, 2019, this strain is available as line #00833 at the RRRC.
This rat is registered at the Rat Genome Database (RGD) ID# 13208224.

Transgene Information

Figure 1:  Schematic of Rosa26-targeted Cre-dependent Cas9 transgene.  The coding region for FLAG-tagged SpCas9 with nuclear-localization signals was amplified from pX458 (Addgene #48138), then inserted downstream of a CAG promoter between a flox-stop cassette and the polyadenylation signal from the gene for bovine growth hormone (pOTTC1080).  The final construct was used as a donor template for homology directed repair of a CRISPR-Cas9 double-strand break targeted by the following guide RNAs:

rRosa26 A         GCAGATCACGAGGGAAGAAG

rRosa26 B         GAGTCTTTCTGGAAGATAGG

The donor template (OTTC1080), the gRNAs (produced by in vitro transcription), and the mRNA encoding the Cas9-nickase (Tri-Link), were injected into fertilized Long Evans rat embryos by NIMH Transgenic Core.  Founder rats were identified then  genotypically and phenotypically verified.

Phenotypic Characterization

Coming soon.

Breeding Strategy

Breeding Information, click here for PDF

Genotyping Assays

Assay for the presence of Rosa26-targeted LSL-Cas9 insert, click here for PDF.

References that cite this rat

@article{Back:2019aac,

title = {Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.},

author = {Susanne Back and Julie Necarsulmer and Leslie R Whitaker and Lamarque M Coke and Pyry Koivula and Emily J Heathward and Lowella V Fortuno and Yajun Zhang and Grace C Yeh and Heather A Baldwin and Morgan D Spencer and Carlos A Mejias-Aponte and James Pickel and Alexander F Hoffman and Charles E Spivak and Carl R Lupica and Suzanne M Underhill and Susan G Amara and Andrii Domanskyi and Jenni E Anttila and Mikko Airavaara and Bruce T Hope and Kent F Hamra and Christopher T Richie and Brandon K Harvey},

url = {https://www.ncbi.nlm.nih.gov/pubmed/30792150},

doi = {10.1016/j.neuron.2019.01.035},

issn = {1097-4199 (Electronic); 0896-6273 (Linking)},

year  = {2019},

date = {2019-04-03},

urldate = {2019-04-03},

journal = {Neuron},

volume = {102},

number = {1},

pages = {105--119},

address = {Molecular Mechanisms of Cellular Stress and Inflammation Section, Intramural Research Program, National Institute on Drug Abuse, National Institutes of Health, Baltimore, MD 21224, USA.},

abstract = {Historically, the rat has been the preferred animal model for behavioral studies. Limitations in genome modification have, however, caused a lag in their use compared to the bevy of available transgenic mice. Here, we have developed several transgenic tools, including viral vectors and transgenic rats, for targeted genome modification in specific adult rat neurons using CRISPR-Cas9 technology. Starting from wild-type rats, knockout of tyrosine hydroxylase was achieved with adeno-associated viral (AAV) vectors expressing Cas9 or guide RNAs (gRNAs). We subsequently created an AAV vector for Cre-dependent gRNA expression as well as three new transgenic rat lines to specifically target CRISPR-Cas9 components to dopaminergic neurons. One rat represents the first knockin rat model made by germline gene targeting in spermatogonial stem cells. The rats described herein serve as a versatile platform for making cell-specific and sequence-specific genome modifications in the adult brain and potentially other Cre-expressing tissues of the rat.},

keywords = {},

pubstate = {published},

tppubtype = {article}

}

Blog/Comments/Reviews

There is only one surveyed report for receiving and usage of the transgenic LSL-Cas9 rats for scientific experiments.

General Health
One PI reported that the LE-Rosa26Tm1(LSL-Cas9)Ottc male breeders received from the RRRC had health issues and needed to be euthanized before a colony was established.

Weight
The are no reports of weights changes with the LE-Rosa26Tm1(LSL-Cas9)Ottc rats

Breeding
One PI reported that they could not establish breeding of LE-Rosa26Tm1(LSL-Cas9)Ottc rats due to health issues with the male breeders.

Expression
There are no reports of expression with the LE-Rosa26Tm1(LSL-Cas9)Ottc rats

Other related rats

No related rats at this time.

Acknowledgements

Susanne Back, YaJun Zhang, Julie Necarsulmer, Pyry Koivula, Emily Heathward, Christopher T. Richie, Brandon Harvey, Janette Lebron