National Institute on Drug Abuse Intramural Research Program

Last Updated on November 12, 2024

Background

CRISPR/Cas9 technology enables the targeting of mutations to specific DNA sequences within an organism’s genome. Cas9 is a nuclease that interacts with a guide RNA (gRNA) whose sequence determines the target DNA site for the Cas9 to create a double-strand break in the genomic DNA. The endogenous repair mechanisms lead to mutant DNA sequence once a double-stranded DNA break has been made. A mutant form of Cas9 (D10A nickase) only cuts one strand of DNA. Using Cas9 nickase and two gRNAs targeting same region of DNA will create a functional double-stranded break but with less chance of off target mutations than the Cas9 wild-type nuclease. To facilitate genome modification in the rat, we generated and characterized a strain of transgenic Long Evans rats with Cre-dependent expression of Cas9 nuclease I (LE-Rosa26Tm1(LSL-Cas9D10A)Ottc). The RAT enables cell/tissue-specific genome modification in the rat when it is combined with a Cre recombinase via viral vector or Cre-driver rat and by providing two proximal gRNAs via viral or non-viral vectors.

Status and Availability

This strain has been published (PMID: 30792150).
As of March 15, 2019, this strain is available as line #834 at the RRRC.
This rat is registered at the Rat Genome Database (RGD) ID# 13602097.

Transgene Information

Figure 1: Schematic of Rosa26-targeted Cre-dependent Cas9n transgene. The coding region for FLAG-tagged SpCas9n with nuclear-localization signals was amplified from pX461 (Addgene #48140), then inserted downstream of a CAG promoter between a flox-stop cassette and the polyadenylation signal from the gene for bovine growth hormone (pOTTC1076). The final construct was used as a donor template for homology directed repair of a CRISPR-Cas9 double-strand break targeted by the following guide RNAs:

rRosa26 A GCAGATCACGAGGGAAGAAG

rRosa26 B GAGTCTTTCTGGAAGATAGG

The donor template (OTTC1076), and plasmids encoding the gRNAs to rat Rosa26 and Cas9 were electroporated into rat spermatogonial stem cells by the lab of Kent Hamra (UTSW), and selected by growth on geneticin-containing media. Geneticin-resistant clones were pooled and transplanted into the testes of an azoospermic male rat, which was subsequently used to sire transgenic LSL-nickase progeny.

Phenotypic Characterization

Coming Soon.

Breeding Strategy

Breeding Information, click here for PDF

Genotyping Assays

Assay for the presence of NeoR and Rosa26, click here for PDF

References that cite this rat

2019

Back, Susanne; Necarsulmer, Julie; Whitaker, Leslie R; Coke, Lamarque M; Koivula, Pyry; Heathward, Emily J; Fortuno, Lowella V; Zhang, Yajun; Yeh, Grace C; Baldwin, Heather A; Spencer, Morgan D; Mejias-Aponte, Carlos A; Pickel, James; Hoffman, Alexander F; Spivak, Charles E; Lupica, Carl R; Underhill, Suzanne M; Amara, Susan G; Domanskyi, Andrii; Anttila, Jenni E; Airavaara, Mikko; Hope, Bruce T; Hamra, Kent F; Richie, Christopher T; Harvey, Brandon K

Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Journal Article

In: Neuron, vol. 102, no. 1, pp. 105–119, 2019, ISSN: 1097-4199 (Electronic); 0896-6273 (Linking).

Abstract | Links

@article{Back:2019aac,

title = {Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.},

author = {Susanne Back and Julie Necarsulmer and Leslie R Whitaker and Lamarque M Coke and Pyry Koivula and Emily J Heathward and Lowella V Fortuno and Yajun Zhang and Grace C Yeh and Heather A Baldwin and Morgan D Spencer and Carlos A Mejias-Aponte and James Pickel and Alexander F Hoffman and Charles E Spivak and Carl R Lupica and Suzanne M Underhill and Susan G Amara and Andrii Domanskyi and Jenni E Anttila and Mikko Airavaara and Bruce T Hope and Kent F Hamra and Christopher T Richie and Brandon K Harvey},

url = {https://www.ncbi.nlm.nih.gov/pubmed/30792150},

doi = {10.1016/j.neuron.2019.01.035},

issn = {1097-4199 (Electronic); 0896-6273 (Linking)},

year  = {2019},

date = {2019-04-03},

urldate = {2019-04-03},

journal = {Neuron},

volume = {102},

number = {1},

pages = {105--119},

address = {Molecular Mechanisms of Cellular Stress and Inflammation Section, Intramural Research Program, National Institute on Drug Abuse, National Institutes of Health, Baltimore, MD 21224, USA.},

abstract = {Historically, the rat has been the preferred animal model for behavioral studies. Limitations in genome modification have, however, caused a lag in their use compared to the bevy of available transgenic mice. Here, we have developed several transgenic tools, including viral vectors and transgenic rats, for targeted genome modification in specific adult rat neurons using CRISPR-Cas9 technology. Starting from wild-type rats, knockout of tyrosine hydroxylase was achieved with adeno-associated viral (AAV) vectors expressing Cas9 or guide RNAs (gRNAs). We subsequently created an AAV vector for Cre-dependent gRNA expression as well as three new transgenic rat lines to specifically target CRISPR-Cas9 components to dopaminergic neurons. One rat represents the first knockin rat model made by germline gene targeting in spermatogonial stem cells. The rats described herein serve as a versatile platform for making cell-specific and sequence-specific genome modifications in the adult brain and potentially other Cre-expressing tissues of the rat.},

keywords = {},

pubstate = {published},

tppubtype = {article}

}

Blog/Comments/Reviews

Last Updated on November 12, 2024

No comments or reviews are available at this time.

Other related rats

No related rats at this time.

Acknowledgements

Susanne Back, YaJun Zhang, Julie Necarsulmer, Emily Heathward , Pyry Koivula, Christopher T. Richie, Brandon Harvey, Janette Lebron